Shaebae109 Shaebae109

22-09-2020
Mathematics

contestada

How far away is a star with a parallax of 2 arc sec in parsecs? In AU?

Respuesta :

austinoliver24 austinoliver24

22-09-2020

Answer:

ear

Step-by-step explanation:

Answer Link

Otras preguntas

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

martha, lee, nancy, paul, and armando have all been invited to a dinner party. They arrive randomly and each person arrives at a different time. in how many way

A measure of whether students get similar scores on the same test given at different times. a) test-retest reliability b) inter-rater reliability c) internal co

The function h(t) = 6sin (3pit - pi/3) + 4 where h(t) is in meters and t is in seconds, models the movement of a spinning wheel relative to the ground. Explain

. A glass tabletop is supported by a rectangular pedestal. If the tabletop is 8 inches wider than the pedestal on each side, what is the perimeter of the glass

What was your reaction to Angela Watson's podcast about the power of asking better questions for self-reflection?

The figure below shows the ideal pattern of movement of a herd of cattle, with the arrows showing the movement of the handler as he moves the herd. The arc the

Which of the following is not an island in the East Indies? Group of answer choices O Borneo O Java O Madagascar O Sumatra

A parachutist's speed during a free fall reaches 132 feet per second. What is this speed in meters per second? At this speed, how many meters will the parachuti

Which of the following pulls content from websites and feeds it automatically to a user's computers? 1) Web browser 2) Search engine 3) RSS reader 4) Social med