baleighnorsey4741 baleighnorsey4741

26-01-2021
Mathematics

contestada

You and your friend are selling raffle tickets for a new laptop you sell 14 more than if your total is 58 tickets

Respuesta :

carlo71762 carlo71762

26-01-2021

Answer:

x - 14 = y

x + y = 58

x is the amount you sold

y is the amount your friend sold

Step-by-step explanation: Sorry if this did not help u.

Answer Link

Otras preguntas

The extended warranty on a mini-fridge costs $41. 25. If the warranty is 12. 5% of the normal price, what is the cost of the mini-fridge itself, to the nearest

9. Why does the author include Information about Margot's breakdown over taking a shower in the school showers?

At which x-value does the cosine function attain a maximum value?.

Another company will lend Maya’s older sister $4,000. Every month, she will pay $11.88 in interest. What is the interest rate, rounded to the nearest tenth of a

the model show's a portion of a DNA strand. What does the pentagon represent in the model?

Gilgamesh built the world's first empire after defeating Sumer and northern Mesopotamia. True or false

The amount of energy needed to change a liquid to a solid is calculated using the enthalpy of ________ and has a __________ sign on the energy value.

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

fter reading the scenario, please respond to A, B, and C below. A. Referencing the scenario, describe the power Congress is exercising and explain why the frame

Phineas Gage underwent a dramatic personality change after a tamping iron inflicted massive damage to his ________ lobes.