huni9xyz huni9xyz

25-09-2021
English

contestada

I speak english, you so

Respuesta :

mariyasunuwar mariyasunuwar

25-09-2021

Answer:

i speak english tooo.was that suppose to be a question ??

Answer Link

ayleenzumba ayleenzumba

25-09-2021

Answer: I speak English too

Explanation:

Answer Link

Otras preguntas

If 1 T = 10 kHz, determine the maximum bandwidth of Xa(t) allowed such that the overall system from Xa(t) to Ya(t) behaves as an LSI system. (Further details ab

Which of the following best explains the overall impact of the greenhouse effect on our planet? 1) It reduces our exposure to harmful wavelengths of light from

A car is traveling downhill on a suburban road with a grade of 4% at a speed of 35 mi/h. Determine the required stopping sight distance. (Answer closest to bein

What changes occurred in the Christian church? What were religious wars in the Christian world fought over? What were religious wars in the Islamic world fought

Sometimes when forming impressions of others, we are influenced by the schemas that are in the forefront of our mind. When this happens, social psychologists ta

Zorosis, a jewelry store, recently discarded its traditional employee training modules and upgraded to an innovative online learning system in which employees a

Of the following individuals, which would be the most likely to develop schizophrenia later in life if the disorder they have is left untreated?a) A person with

education is the key to success

4. PCR Primer design (4 points) You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this

Açık Tohumluların gövdesinde hangi yapraklar bulunur