gracib67 gracib67

26-01-2022
Mathematics

contestada

The sum of two numbers is 72. Their difference is 10. Find the numbers.

Respuesta :

louloveslions1 louloveslions1

26-01-2022

Answer:

80 and 8

Step-by-step explanation:

Substitute x in first equation with x=10y. So y = 8. x=80. Thus the 2 numbers are: x=80 and y=8.

Answer Link

Otras preguntas

A leveraged ETF aims to provide a 3x multiple of the daily return of the underlying index. The underlying index is 100 at the start, rises by 10% (to 110) on th

How can leadership for a cancer survivorship program create a detailed action plan to implement regular seminars where researchers share their latest findings?

A force F1 of 18.8 N pulls at an angle of 12° above due east. A force F2 of 3.2 N pulls at an angle of 88° below due east. Find the magnitude of the resultant f

To make room for building new houses, a construction company removes all of the trees from a section of a forest. Which group of organisms below will be impacte

Which of these should you look for when you preview a text? • a. a summary at the end of the text • b. the hidden agenda of the author • c. what the text is abo

1. Working title of your TED Talk: 2. What, specifically, do you want an audience to learn and take away from your TED Talk? (Think of the audience in terms of

All budget options have lifetime pacing. A. true B. false

Write the formula for an exponential function with initial value 300 and decay factor 0.83. (use t as your variable.) n =

Identity the market forms of fish, and Give one example of dish where this market form usually use

4. PCR Primer design (4 points) You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this