slolyki slolyki

22-09-2017
World Languages

contestada

which of the following pairs of words are antonyms

despondent, ecstatic

solitude, lonely

captivity, slavery

essay, clarity

Please help me

Respuesta :

Аноним Аноним

22-09-2017

an antonym is the opposite, so despondent, ecstatic would be the correct answer.

Answer Link

Otras preguntas

A cylindrical can holds 1 liters (1000 cm^3) of liquid. How should the height and radius be chosen to minimize the amount of material needed to manufacture the

Fill in the blanks with the correct demonstrative adjective (este, esta, ese, esa, aquel, aquella, estos, estas, esos, esas, aquellos, aquellas). YOU MAY TAKE T

Select the correct answer. Which accurately describes a letter written during the time a historical event occurred? 0 A effective secondary source document B. t

Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGCCTAGTAGCCTTC(3). What is RNA seq

When Mohesha receives an increase in her pay check from $1,800 a month to $2,200 a month, she increases the quantity of hot chocolate that she buys from 19 c

The osmotic pressure of a solution containing 5.87 mg of an unkonw protein per 10 ml of solution is 2.45 torr at 25 degree clesius. Find the molar mass of the u

this is the process that releases energy by breaking down food molecules in the precence of oxygen

Read the excerpt from Walt Whitman's "Song of Myself." These are really the thoughts of all men in all ages and lands, they are not original with me, If they ar

Was Durer Roman Catholic or Protestant?

Remember, a pro supports a claim, while a con supports a counterclaim. Claim: This is the best car model available. Counterclaim: That model received poor safet